Aerobic Plate Count of Contaminants and Molecular Characterization of Eschereichia Coli in Raw Chicken Meat in Ismailia, Egypt
Abstract
A total number of 100 samples from ten random broiler chicken carcasses (breast and thigh) were collected from an automatic poultry slaughtering plant in Ismailia city, Egypt. The mean values of Enterobacteriacae count were 5.9x104±9.7x103 cfu/g and 7.1x 104 ± 1.1x104 cfu/g for chicken breast and thigh samples respectively. The prevalence of E.coli were 12% and 9% breast and thigh samples examined, respectively. They are serologically identified as 33.35 and 22.2% O157:H7 (EHEC) , 16.6% and 11.1% O114:H21(EPEC), 16.6% and 33.3 %O127:H6 (ETEC) , 0% and 0% O126 (ETEC) and 33.3% and 0% O26 (EHEC) for breast and thigh samples, respectively. The incidence of E.coli O157:H7 was 100% in both serological and PCR methods from biochemical positive E.coli samples. Culture is specific and cheap whereas PCR is sensitive and expensive, hence, we recommend both culture and molecular methods, which improve sensitivity and specificity, to enhance detection of foodborne pathogens including E.coli.
Article Information
- Received
- Accepted
- Published
Academic Editor: María Del Refugio Castañeda-Chávez, Tecnológico Nacional de México/Instituto Tecnológico de Boca del Río, 94290 Veracruz, Mexico.
Checked for plagiarism: Yes
Review by: Single-blind
Copyright © 2020 El-Sayed A. Afify, et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Corresponding author: Fahim A Shaltout, Department of Food Control, Faculty of Veterinary Medicine, Benha, University, Egypt —
Competing Interests
The authors have declared that no competing interests exist.
Funding
No specific funding statement was provided by the authors.
Data Availability
No data-availability statement was provided by the authors.
Citation:
Introduction
Chicken meat is one of the most popular foods among developed and developing countries .It contains essential amino acids, minerals including sodium, potassium calcium, iron, phosphorous besides, and traces of vitamins such as vitamin B12 and niacin required for growth and carry on life1.
Chicken meat is a common source of pathogenic bacteria such as Escherichia coli 2.
Poultry meat is an ideal medium for bacterial growth and is known to harbor a large number of bacteria that are pathogenic to human. Typically, contamination with bacteria occur in low sanitation levels, and only pose a threat to the consumer if the product is not handled.
Escherichia coli is considered as a commensal in the alimentary tract of domestic and wild animals as well as man. E. coli isone of the important food borne pathogen of public health interest incriminated in poultry meat worldwide3. E. coliO157:H7 has the ability to tolerate acidic condition of the stomach, The infective dose of E.coli O157:H7 ranges from 10 to 100 cells /g4.
The detection of foodborne pathogens using conventional culture methods have been considered as the “gold standard” for the isolation and identification of foodborne bacterial pathogens5. Culture steps include nonselective enrichment, selective enrichment, selective/differential plating, morphological, biochemical and serological confirmation. Culture isolation and identification is known to be specific and inexpensive, but method is labor-intensive and time-consuming, because it require at least, three working days to produce a negative result and five to ten working days for confirming positive results. Moreover, due to environmental factors, variations in gene expression of microorganisms can occur and may affect the results of biochemical tests. Viable but non cultivable cells are not detected by the conventional cultural methods6.
Polymerase chain reaction (PCR) is a method used for the in vitro enzymatic synthesis of specific DNA sequences by Taq or other thermo resistant DNA polymerases. PCR uses oligonucleotide primers that are usually 20-30 nucleotides in length and whose sequence is homologous to the ends of the genomic DNA region to be amplified. The method is performed in repeated cycles, so that the products of one cycle serve as the DNA template for the next cycle, doubling the number of target DNA copies in each cycle7. PCR represents a rapid procedure with high sensitivity and specificity for the immediate detection and identification of specific pathogenic bacteria from different food materials8.
Material and Methods
Collection of Samples
A total of 100 samples from ten random broiler chicken carcasses (about 2kg in weight) were collected after complete preparation involving (washing in achiller, slaughtering, scalding, defeathering and evisceration), at an automatic poultry slaughtering plant in Ismailia city, Egypt. The samples were kept separately in plastic bags, and transported immediately to the laboratory in an insulated ice box under aseptic conditions.
Bacteriological Examination
Conventional Recovery Methods
Preparation of Samples
The samples were prepared according to the technique recommended ICMSF9.
Twenty-five grams of a samples was taken by sterile scissors and forceps after surface sterilization by hot spatula, then transferred to sterile polyethylene bags, to which 225 ml of 0.1% of sterile buffered peptone water (0.1%) was aseptically added. Each sample was then homogenized for 2 minutes at 2500 r.p.m. using a sterile homogenizer to achieve 1/10 dilution. The homogenate was allowed to stand for 15 minutes at room temperature. One ml from such dilution was transferred to a second sterile tube containing 9 ml sterile buffered peptone water and mixed well. Further decimal serial dilutions were prepared accordingly. This samples of all groups were subjected to the following examination.
Determination of aerobic plate count10:was conducted: using standard plate count agar media. While, Determination of Enterobacteriaceae count11 was conducted :using violet red bile glucose agar media (VRBG). Isolation and Identification of E.coli12: using MacConkey broth and Eosin Methylene blue plates. The metallic green colonies were picked up and identified biochemically and serologically.
Polymerase Chain Reaction (PCR)
DNA Extraction
DNA extraction from samples was performed using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) according to manufacturer’s recommendations with modifications. Briefly, 200 µl of the sample suspension was incubated with 10 µl of proteinase K and 200 µl of lysis buffer at 56OC for 10 min. After incubation, 200 µl of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer’s recommendations. Nucleic acid was eluted with 100 µl of elution buffer.
Oligonucleotide Primer
Primers used were supplied from Metabion (Germany) (Table 1)
Table 1. Primers sequences, target genes, amplicon sizes and cycling conditions.| Target gene | Primers sequences | Amplified segment (bp) | Primarydenaturation | Amplification (35 cycles) | Final extension | Reference | ||
| Secondary denaturation | Annealing | Extension | ||||||
| E.coli O157:H7 fliC | GCGCTGTCGAGTTCTATCGAGC | 625 | 94˚C5 min. | 94˚C30 sec. | 57˚C40 sec. | 72˚C45 sec. | 72˚C10 min. | 15 |
| CAACGGTGACTTTATCGCCATTCC | ||||||||
PCR Amplification
Primers were utilized in a 25µl reaction containing 12.5 µl of EmeraldAmp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentration, 4.5 µl of water, and 6 µl of DNA template. The reaction was performed in an Applied biosystem 2720 thermal cycler.
Analysis of the PCR Products.
The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 20 µl of the products was loaded in each gel slot. Generuler 100 bp ladder (Fermentas, Germany) was used to determine fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software.
Statistical Analysis
All the obtained results were evaluated statistically using Analysis of variance (״Anova test) statistic “16.
Results
The initial (cfu/g) mean values of aerobic plate count of fresh chicken breast and thigh samples were 5.1x104 ±3.2x104 cfu/g and 6.1x105±5.6x105 cfu/g respectively (Table 2). The initial (cfu/g) mean values of total Enterobacteriaceae count of fresh chicken breast and thigh samples were 5.9x104±9.7x103 cfu/g (Table 3).E.coli was isolated from 12% and 18% of the examined fresh chicken breast and thigh samples respectively (Table 4). Using serology,E.coli serogroups isolated from breast samples were 2 (33.3%) O157:H7 (EHEC), 1 (16.6%) O114:H21 (EPEC), 1(16.6%) O127:H6 (ETEC), and 2 (33.3%) belonged to O26 (EHEC) (Table 5).
Table 2. Total aerobic plate count (APC) of examined chicken samples (n =100).| Chicken meat samples | Total aerobic count (n=100) | ||||
| Positive samples | Count C.F.U./g | ||||
| No. | % | Min. | Max. | Mean ± SE | |
| Chicken breasts | 50 | 100 | 3.5x103 | 7.2x106 | 5.1x104 ±3.2x104 |
| Chicken thighs | 50 | 100 | 4.6x104 | 8.8x106 | 6.1x105 ±5.6x105 |
| Chicken meat samples | Total Enterobacteriacae count (n=48) | ||||
| Positive samples | Count C.F.U./g | ||||
| No. | % | Min. | Max. | Mean ± SE | |
| Chicken breasts | 21 | 42 | 3.1x104 | 8.2x104 | 5.9x104±9.7x103 |
| Chicken thighs | 27 | 54 | 5.4x104 | 9.6x104 | 7.1x104±1.1x104 |
| Micro oragnisms | Examined chicken samples (n=50) | |||
| Chicken breasts | Chicken thighs | |||
| No. | %* | No. | %* | |
| Staphylococcus aureus | 5 | 10 | 2 | 4 |
| Salmonella | 7 | 14 | 4 | 8 |
| Escherichia coli | 6 | 12 | 9 | 18 |
| Klebsiella sp. | 0 | 0 | 2 | 4 |
| Enterobacter sp. | 2 | 4 | 1 | 2 |
| Proteus sp | 1 | 2 | 1 | 2 |
| Shigella sp. | 1 | 2 | 0 | 0 |
| Clostridium perfringens | 8 | 16 | 5 | 10 |
| total | 30 | 60 | 24 | 48 |
Similarly, E.cloi isolates from thigh samples were 2(22.2%) O157:H7 (EHEC), 1(11.1) O114:H21 (EPEC), 3(33.3) O127:H6 (ETEC), and 3(33.3) belonged to O126 (ETEC) .All 100% of the identified Ecoli O157,isolates from chicken meat samples were positive by PCR (Table 6, Figure 1).
Table 6. Using PCR for detection of Ecoli o157.| Examined isolates | Number of positive samples | % | |
| Traditional methods | PCR | ||
| No. | No. | ||
| Ecoli o157 | 4 | 4 | 100 |
Figure 1. positive gene amplification at 625bp for Ecoli O157.
Download figure
Discussion
Aerobic Plate Count gives an idea about the hygienic measures applied during processing to helps in the determination of the keeping quality of the poultry carcasses. Similar results were reported 17 for chicken thigh samples for where APC was 2.5×10⁵ cfu/g and 18 for breast samples where APC was 243.90×10⁴cfu/g and 69.60 ×10⁴cfu/g. On the other hand, higher counts were reported 19with values of 3.38x10⁶±1.02x10⁶cfu/g. Aerobic plate counts were 1.75×105±1.6×105cfu/g in freshly slaughtered breast meat samples20. Comparatively, lower counts were reported by21where APCwas 4.2 ×102 cfu/g in raw chicken breast samples Similarly, it was found that APC in examined chicken thigh samples were 6.84×105 ±1.65×104cfu/g 22.
Total Enterobacteriaceae Count (TEC)
Enterobacteriaeace count is more frequently used to assess enteric contamination. Nearly similar results were reported bywhich Enterobacteriaeace counts were 5.26×10⁴ in examined chicken breast muscle samples 23. In a similar study it was reported that Enterobacteriaeace counts were 9.5×10⁴±0.9×10⁴cfu/g in examined chicken breast samples20. In addition, higher counts of Enterobacteriacaecounts were reported (3.9 ×10⁵ and 3×10⁵ cfu/g, respectively)24 in chicken thighs and breast samples tested microbiologically25.Another investigator reported thatEnterobacteriaeace counts in examined chicken carcasses samples were 1.57-2.17×10⁶cfu/g25. On the other hand, a lower count was reported by26 in which the mean counts of Enterobacteriacae in chicken breast samples was 1.5×10≥±2.3×10² cfu/g.
Prevalance and Serotyping of Escherichia coli. Isolated from the Examined Chicken Samples
The presence of E.coli in food of animal origin is considered as an indicator of faults during preparation, handling, storage or service27. Nearly similar results were reported E.coliwas isolatedfrom 13.33% thigh samples28. Moreover higher percentages of Escherichia coli were reported by29who founded that the prevalence and load of E.coli in chicken meat sold in retail market in Uttar Pradesh was 68% of the examined samples,30 who reported that 45% of the chicken samples collected from retail outlets were positive for E.coli. On the other hand21 failed to detect E. coli O157:H6 targeted samples, whereas only 2% positive samples were reported out of 50 tested31.
Using serology O157:H7 (EHEC),1(16.6%) which was belonged to O114:H21(EPEC), O127:H6 (ETEC) and O26 (EHEC) were identified from breast sampls,. while, O157:H7 (EHEC), O114:H21(EPEC) ,O127:H6 (ETEC) and O126 (ETEC) were identified from thigh samples.
Enterotoxigenic E.coli (ETEC) strains are considered the common cause of traveller`s diarrhea and / or children diarrhea. ETEC may contaminate ready to eat food through a symptomatic carrier, a person who recovers from an ETEC infection and continue to excrete the organism for several months.
On the other hand, Enteroheamorrhagic E.coli (EHEC) can cause sever illnesses characterized by sudden onset of severe crampy abdominal pain followed by watery diarrhea, which later on becomes bloody. There may be little or no fever and the duration of illness is 2 to 9 days. Death rate in some reported outbreaks may reach 36%. Since 1982, more than 10650 outbreaks of EHEC were reported in USA32.
Polymerase Chain Reaction (PCR)
All 100% of Ecoli o157, isolates identifiedserologically from chicken meat samples were positive by PCR. Thus there was complete agreement between the results of serological methods and PCR technique for identification of Ecoli o157. Accordingly, the application of one of these trials is sufficient and accurate for identification of such organism.
This agrees with the report33 who observed similar findings between multiplex PCR and microbiological/biochemical methods Microbiological method is still the method of choice of isolation and identification of food pathogens owing to its availability and ease of application.
Tables & Figures
| Target gene | Primers sequences | Amplified segment (bp) | Primarydenaturation | Amplification (35 cycles) | Final extension | Reference | ||
| Secondary denaturation | Annealing | Extension | ||||||
| E.coli O157:H7 fliC | GCGCTGTCGAGTTCTATCGAGC | 625 | 94˚C5 min. | 94˚C30 sec. | 57˚C40 sec. | 72˚C45 sec. | 72˚C10 min. | 15 |
| CAACGGTGACTTTATCGCCATTCC | ||||||||
| Chicken meat samples | Total aerobic count (n=100) | ||||
| Positive samples | Count C.F.U./g | ||||
| No. | % | Min. | Max. | Mean ± SE | |
| Chicken breasts | 50 | 100 | 3.5x103 | 7.2x106 | 5.1x104 ±3.2x104 |
| Chicken thighs | 50 | 100 | 4.6x104 | 8.8x106 | 6.1x105 ±5.6x105 |
| Chicken meat samples | Total Enterobacteriacae count (n=48) | ||||
| Positive samples | Count C.F.U./g | ||||
| No. | % | Min. | Max. | Mean ± SE | |
| Chicken breasts | 21 | 42 | 3.1x104 | 8.2x104 | 5.9x104±9.7x103 |
| Chicken thighs | 27 | 54 | 5.4x104 | 9.6x104 | 7.1x104±1.1x104 |
| Micro oragnisms | Examined chicken samples (n=50) | |||
| Chicken breasts | Chicken thighs | |||
| No. | %* | No. | %* | |
| Staphylococcus aureus | 5 | 10 | 2 | 4 |
| Salmonella | 7 | 14 | 4 | 8 |
| Escherichia coli | 6 | 12 | 9 | 18 |
| Klebsiella sp. | 0 | 0 | 2 | 4 |
| Enterobacter sp. | 2 | 4 | 1 | 2 |
| Proteus sp | 1 | 2 | 1 | 2 |
| Shigella sp. | 1 | 2 | 0 | 0 |
| Clostridium perfringens | 8 | 16 | 5 | 10 |
| total | 30 | 60 | 24 | 48 |
| Examined isolates | Number of positive samples | % | |
| Traditional methods | PCR | ||
| No. | No. | ||
| Ecoli o157 | 4 | 4 | 100 |
Figure 1. positive gene amplification at 625bp for Ecoli O157.
Download figure
References
- 1.(FAO)FoodandAgricultureOraganization.(2014).The role of poultry in human nutrition available at: www FAO.org/ docrp/ 013/ a1713e/a1713e00.
- 2.Cason J A, Hinton A, Ingram K D. (2000) Coliform, Escherichia coli, and Salmonella concentration in a multiple-tank, counter flow poultry scalder.J. Food. Prot.63: 1184-1188.
- 3.Adeyanju G T, Ishola O. (2014) Salmonella and Escherichia coli contamination of poultry meat from a processing plant and retail markets in Ibadan. , Oyo State, Nigeria 3, 13914-7.
- 4.Doyle M P, Robert L, Buchanan.. (1997).Food borne disease Significance ofE.coli O157 :H7and other EnterohemorhagicE.coli. J.of Food Technology 51(10).
- 5.Jasson V, Jacxsens L, Luning P, Rajkovic A, Uyttendaele M. (2011) Alternative microbial methods: An overview and selection criteria. , Food Microbiol 27, 710-730.
- 6.Malorny B, Tassios P T, Radstrom P, Cook N, Wagner M. (2003) Standardization of diagnostic PCR for the detection of foodborne pathogens. , Int J Food Microbiol 83, 39-48.
- 7.Hill,W.E.(1996): The polymerase chain reaction: application for the detection foodborne pathogens. , CRC Crit Rev Food Sci Nutrit 36, 123-173.
- 8.J L McKillip, Drake M. (2004) Real-time nucleic acid-based detectionmethods for pathogenic bacteria in food. , J Food Prot 67, 823-832.
- 9.International Commission on Microbiological Specification for Foods˵ ICMSF˶(1978): Microorganisms in foods. their significance and methods of enumeration (2nd ed). University of Toronto press. , Toronto Canada
- 12.American Public.Health Association.(1992).Compendium of methods for microbiological examination of Food. 3rdEd , Brothers, Ann, Arb .
- 13.Hu Q, Tu J, Han X, Zhu Y, Ding C. (2011) Development of multiplex PCR assay for rapid detection of Riemerella anatipestifer Esherichia coli and salmonella enterica simultaneously from ducks. , J. Microbiol.Methods,87: 64-69.
- 14.Dipineto L, Santaniello A, Fontanella M, Lagos K, Fioretti.. A.,Menna,LF.(2006). Presence of Shiga toxin-producingE.coliO157: H in living layer hens. Letters in Applied Microbiol 43, 293-295.
- 15.P M Fratamico, Bagi L K andPepe, T. (2000) A multiplex polymerase chain reaction assay for rapid detection and identification of Escherichia coli. O157:H7 in foods and bovine feces.J Food Prot.;63(8): 1032-7.
- 16.Feldman D. (2003) The solution for data analysis and presentation graphics. 2nd Ed., Abacus Lancripts, Inc. , Berkeley, USA
- 17.E A Morshedy.A .M .and Sallam ,K .I.(2002):Improving of Sanitary status of broiler carcasses during their processing . 6thVet. Med . Zagazig. Conference (7-9 sept.2002) , Hurghada .
- 18.Sengupta R, Da R, S andMukhopadhayay Ganguly, K S. (2011) Survey on microbial quality of chicken meat. in Kolkata, India. International J.of Researchin pure and Applied Microbiology 1(3), 32-33.
- 19.Morshdy A M A, A E Hafez, A M Mostafa, EL-Sayed O, A. (2008) Bacterial evaluation of marketed chicken carcasses inDakahliaProvince and improvement with lactic acid. , Zag. Vet 36(5), 93-100.
- 20.F N EI-Shopary. (2013) Effect of antibiotic residues on the sanitary statusand storage period of poultry meat.Ph .D.Thesis (Meat Hygiene) .Fac. Vet.Med. Zagazig.Univ.Egypt
- 21.Allah Abd, H W.andHassan,A.A.(2000): Sanitary status of ready to eat meat meals incairoand Giza Governorates.J .Egypt. , Vet. Med 60(7), 95-104.
- 22.Mousa M M, Bkhiet.AA,Abd-ElTawabE.(2000).Bacteriological aspect of pre-cooked deboned poultry meat inDamanhour. The second International Scientific Conference.The roleof Vet. Med. Mansoura Univ: 255-268.
- 24.Osman ,E.M.S.(2001): Quality assurance of locally dressed broiler´s cuts and theirproducts.CairoUniv,Facof vet Med .
- 25.S N Rindhe, P N Zanjad, V K Doifode, Siddique.A .andMendheM.S. (2008): Assessment of microbial contamination of Chicken products sold inParbhanicity.VeterinaryWorld,1(7):. 208-212.
- 26.Tolba K.(2000):Sanitary status of marketed frozen chicken productsexhibited in presentation freezer. , J. of VeterinaryMedecine, Giza 217.
- 27.Tebbut,G.M.(1999): Microbiological contamination of cooked meats International Commission on and environmental site in premise selling both raw and cooked meat products. , Int. J. Environm. Health Research 3(4), 209-216.
- 28.Ibrahim H M, Amin R A, El-Shater M A, Hafez Salwa M. (2015) Bacteriological evaluation of freshly slaughtered chicken carcasses. , Benha. Vet. Med.J,28 2, 74-82.
- 29.Joshi.and Joshi ,R.K.(2010): Bacteriological quality of meat sold in retail market in Uttar Pradesh. , J. of Veterinarian Public Health 8(2), 137-139.
- 30.Ahmed M U D, Sarwar A, M I Najeeb, Nawaz M. (2013) assessment of microbial load of raw meat at abattoirs and retail outlets.The. , Journal of Animal & Plant Sciences 23(3), 745-748.
- 31.C B Kiranmayi, Krishnaiah N. (2010) Detection of E.coli O157 H7 prevalance in foods of animal origin by cultural methods and PCR technique. Veterinary World. 3(1), 13-16.
Cited by (3)
This article has been cited by 3 scholarly works according to:
Citing Articles:
Foods (2025) Crossref Semantic Scholar OpenAlex
International Journal of Veterinary Science (2023) OpenAlex
Shahjada Mohammad Julqarnain, Palash Bose, Md Rahman, M. Khatun, Md. Ariful Islam - Journal of Advanced Veterinary and Animal Research (2022) Semantic Scholar
